Znaleziono 7 wyników

Wyszukiwanie zaawansowane

autor: Modern-Science
06 sie 2015, czw, 14:45
Forum: Nauki ścisłe
Temat: Wizualizacja sekwencji nukleotydów, sekwencja DNA
Odpowiedzi: 0
Odsłony: 8423

Wizualizacja sekwencji nukleotydów, sekwencja DNA

http://wm42.inbox.com/thumbs/1_40f603_e32a34_oG.gif.thumb TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT CCGGTATGAATTCTCCGCGCAAT...
autor: Modern-Science
20 wrz 2012, czw, 23:59
Forum: Nauki humanistyczne
Temat: Geneza monoteizmu
Odpowiedzi: 7
Odsłony: 12642

Re: Geneza monoteizmu

kazymyr pisze:Czy Abraham lub Mojżesz mógł szukać Jedynego Prawdziwego Boga u takiego politeisty jakim był Hammurabi?

Mojżesz szukał ale u Echnatona, natomiast Abraham nie znał monoteizmu

kazymyr pisze:Poza tym Prawdziwy Bóg nie moż zostać przez kogoś wymyślony

Jeżeli jest wytworem fikcji to może
autor: Modern-Science
17 sie 2011, śr, 20:32
Forum: Nauki humanistyczne
Temat: Geneza monoteizmu
Odpowiedzi: 7
Odsłony: 12642

niezupełnie po pierwsze, opieram się również na tekście do którego dałem link który wydaje się dość miarodajny po drugie, encyklopedie takie jak 10 tomowa PWN wcale nie są popularne tylko korzystają z pracy specjalistów wysokiej klasy z różnych dziedzin i mają dużą dokładność a przypomnę że encyklop...
autor: Modern-Science
01 sie 2011, pn, 12:50
Forum: Nauki humanistyczne
Temat: Geneza monoteizmu
Odpowiedzi: 7
Odsłony: 12642

Dodam jeszcze że według Powszechnej encyklopedii PWN (10 tomów) Abraham jest datowany na około XV p.n.e "Abraham, Abram, żył w XV(?) w. p.n.e." Jego 'przymierze' z Jahwe dopuszczało istnienie innych bóstw i było w stylu politeistycznej monolatrii Hammurabiego. Natomiast dyskutowany artykuł...
autor: Modern-Science
01 sie 2011, pn, 12:23
Forum: Nauki humanistyczne
Temat: Geneza monoteizmu
Odpowiedzi: 7
Odsłony: 12642

Jednak badania naukowe wykazują że twórcą monoteizmu był Echnaton (Amenhotep IV) z MSN Encarta Encyclopedia: " Akhenaton was the last important ruler of the 18th dynasty and notable as the first historical figure to establish a religion based on the concept of monotheism" z komentarzem z a...
autor: Modern-Science
31 gru 2010, pt, 09:44
Forum: Nauki humanistyczne
Temat: Geneza monoteizmu
Odpowiedzi: 7
Odsłony: 12642

Geneza monoteizmu

W linkowanym poniżej artykule autor przedstawia kilka ciekawych informacji na temat historycznych początków monoteizmu i tak zwanych świętych ksiąg głównych religii monoteistycznych - jest to tekst krytyczny wobec religii i warty lektury ze względu na ciekawe cytaty oraz garść ważnych informacji na ...
autor: Modern-Science
08 sie 2008, pt, 20:20
Forum: Nauki ścisłe
Temat: Nowy obraz ewolucji
Odpowiedzi: 2
Odsłony: 8431

Nowy obraz ewolucji

Na stronie http://popf.glt.pl/biomorfozaiewolucja.php zamieszczono artykuł polskiego filozofa nauki opisujący ważne rozwinięcie teorii ewolucji, które wychodząc od kwestii społecznych wchłonęło pozniej w swoje ramy nawet punktualizm Goulda i Eldredge'a - który postulował pierwszą poważną reinterpret...

Wyszukiwanie zaawansowane

cron